 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0080210/circ-GRB10 | |||
| Gene | GRB10 | Organism | Human |
| Genome Locus | chr7:50737418-50773020:- | Build | hg19 |
| Disease | Intervertebral disc degeneration | ICD-10 | Other specified intervertebral disc degeneration (M51.3) |
| DBLink | Link to database | PMID | 29476072 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | Human lumbar degenerative NP specimens were obtained from 20 patients with IDD undergoing discectomy. The control samples were taken from 20 age- and sex-matched patients with fresh traumatic lumbar fracture who underwent anterior decompressive surgery because of neurological deficits. |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCCGCCGCAAAGCAGATATTC ReverseACAGACTCCAGCAGGGTCAG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Guo, W, Zhang, B, Mu, K, Feng, SQ, Dong, ZY, Ning, GZ, Li, HR, Liu, S, Zhao, L, Li, Y, Yu, BB, Duan, HQ, Sun, C, Li, YJ (2018). Circular RNA GRB10 as a competitive endogenous RNA regulating nucleus pulposus cells death in degenerative intervertebral disk. Cell Death Dis, 9, 3:319. | |||